SubtiBank SubtiBank
Version comparison:

2017-8-11 16:0:32025-05-23 09:45:01

_ec

description

two-component response regulator, regulation of degradative enzyme expression, genetic competence, biofilm formation, capsule biosynthesis (together with SwrAA), non-phosphorylated DegU is required for swarming motility

two-component response regulator, regulation of degradative enzyme expression, [SW|genetic competence], [SW|biofilm formation], capsule biosynthesis (together with [[protein|SwrA]]), non-phosphorylated DegU is required for swarming motility

locus

BSU35490

BSU_35490

geneLength

687

690

function

regulation of degradative enzymes, genetic competence,

regulation of degradative enzymes, [SW|genetic competence], and other adaptive responses

outlinks

bsu

BSU35490

BSU_35490

The protein

Modification

phosphorylated by [[protein|DegS]] on Asp-56 [Pubmed|1901568], this modulates DNA-binding activity

phosphorylation by [[protein|DegS]] occurs in response to inhibition of flagellar rotation [Pubmed|23888912]

phosphorylated by [[protein|DegS]] on Asp-56 [Pubmed|1901568], this modulates DNA-binding activity

phosphorylation by [[protein|DegS]] occurs in response to inhibition of flagellar rotation [Pubmed|28800172,23888912]

The protein

Additional information

[[protein|DegU]]-P is degraded by [[protein|ClpC]]-[[protein|ClpP]] [Pubmed|20070525]

accumulation of [[protein|DegU]]-P results in decreased transcription of the [[gene|epsA]]-[[gene|epsO]] and [[gene|tapA]]-[[gene|sipW]]-[[gene|tasA]] operons due to increased levels of [[protein|Spo0A]]-P [Pubmed|24123822]

[[protein|DegU]]-P is degraded by [[protein|ClpC]]-[[protein|ClpP]] [Pubmed|20070525]

accumulation of [[protein|DegU]]-P results in decreased transcription of the [[gene|epsA]]-[[gene|epsO]] and [[gene|tapA]]-[[gene|sipW]]-[[gene|tasA]] operons due to increased levels of [[protein|Spo0A]]-P [Pubmed|24123822]

information on binding sites can be found in the [http://www.prodoric2.de/detail.php?acc=MX000030 PRODORIC2 database]

References

Original Publications

17850253, 8878039, 14563871, 1901568, 1321152, 1459944, 18194340, 18978066, 10908654, 18502860, 10094672, 19389763, 20815827, 21742882, 18414485, 19420703, 2428811, 7746142, 18502860, 19389763, 19416356, 19734658, 1688843, 20070525, 18197985, 15598897, 12950930, 17590234, 8955341, 22496484, 22745669, 23123903, 21965392, 24123822, 24296669, 122328658, 23888912, 24149708, 24317403, 25431404, 25433860, 24386445, 25777015, 25880922, 25887289, 25755103, 26819068, 23650349, 27026185, 27920766

17850253, 8878039, 14563871, 1901568, 1321152, 1459944, 18194340, 18978066, 10908654, 18502860, 10094672, 19389763, 20815827, 21742882, 18414485, 19420703, 2428811, 7746142, 18502860, 19389763, 19416356, 19734658, 1688843, 20070525, 18197985, 15598897, 12950930, 17590234, 8955341, 22496484, 22745669, 23123903, 21965392, 24123822, 24296669, 122328658, 23888912, 24149708, 24317403, 25431404, 25433860, 24386445, 25777015, 25880922, 25887289, 25755103, 26819068, 23650349, 27026185, 27920766, 28800172, 29124898, 33144634

The protein

Paralogous protein(s)

[[this]]

The protein

[SW|Domains]

[SW|Response regulatory domain] (aa 5-121) (according to UniProt)

[SW|HTH luxR-type domain] (aa 159-224) (according to UniProt)

Biological materials

Mutant

GP2644([[gene|degU]]::''aphA3''), available in [SW|Jörg Stülke]'s lab

BKE35490 (Δ[[gene|degU]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE35490 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAAGCCACGCCTCCTTGT, downstream forward: _UP4_TAGTATAATAGGAGACTTGC

BKK35490 (Δ[[gene|degU]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK35490 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAAGCCACGCCTCCTTGT, downstream forward: _UP4_TAGTATAATAGGAGACTTGC